other:Article Title: Unveiling the physiological impact of ESCRT-dependent autophagosome closure by targeting the VPS37A ubiquitin E2 variant-like domain.
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Mouse: C57BL/6J The Jackson Laboratory Cat# JAX 000664; RRID: RRID:IMSR_JAX:000664 Mouse: C57BL/6 VPS37Aflox/flox Cyagen N/A Oligonucleotides Primers See Tables S3 and S4 – siRNA ON-TARGETplus SMART Pool Non-targeting Dharmacon Cat# D-001810-10 siRNA ON-TARGETplus SMART Pool mouse TBK1 Dharmacon Cat# L-063162-00 Recombinant DNA Plasmid: FUGW-PK-hLC3 Tanida et al.100 Addgene Plasmid #61460; RRID:Addgene_61460 Plasmid: mVenus-C1 Koushik et al.101 Addgene Plasmid #27794; RRID:Addgene_27794 Plasmid: pBABE-neo largeT cDNA Hahn et al.102 Addgene Plasmid #1780; RRID:Addgene_1780 Plasmid: pCDH-Cuo-MCS-EF1a-CymR-T2A-Puro System Biosciences Cat#QM800A-1; Plasmid: pEGFP-flag-APEX2-a-tubulin Lam et al.70 Addgene Plasmid #66171; RRID:Addgene_66171 Plasmid: pEGFP-VPS4-E228Q Votteler et al.103 Addgene Plasmid #80351; RRID:Addgene_80351 Plasmid: pMRX-IB-HaloTag7-mGFP Yim et al.58 Addgene Plasmid #184903; RRID:Addgene_184903 Plasmid: lentiCRISPRv2 puro Stringer et al.104 Addgene Plasmid #98290; RRID:Addgene_98290 Plasmid: lentiCRISPR v2 targeting hVPS37A #1-3 Takahashi et al.7 N/A Plasmid: lentiCRISPR v2 targeting mATG7 This study N/A Plasmid: pCDH1-Ubc-HT-LC3 This study N/A Plasmid: pCDH-mVenus-Hygro This study N/A Plasmid: pCDH1-mVenus-hVPS37A WT This study N/A Plasmid: pCDH1-mVenus-hVPS37A K382D This study N/A Plasmid: pCDH1-mVenus-mVPS37A WT This study N/A Plasmid: pCDH1-mVenus-mVPS37A K382D This study N/A Plasmid: pCDH-FLAG-APEX2-LC3B This study N/A Plasmid: pCDH-TRE3G-GFPDNVPS4-tet-on-3G This study N/A Software and algorithms Image Studio software version 5.2 LI-COR Biosciences RRID:SCR_015795 GraphPad Prism 7.0 GraphPad Prism RRID:SCR_002798 Leica Application Suite X Leica RRID:SCR_013673 Huygens Scientific Volume Imaging RRID:SCR_014237 Volocity PerkinElmer RRID:SCR_002668 Imaris Bitplane RRID:SCR_007370 ImageJ Schneider et al.105 RRID:SCR_003070 Fragpipe v.19.0 Nesvizhskii lab RRID:SCR_022864 MSFragger v.3.7 Nesvizhskii lab106 N/A Scaffold Proteome Software Proteome Software, Inc. RRID:SCR_014345 Cell Reports 43, 115016, December 24, 2024 23 vector containing loxP recombination site. gRNAs (ACCCGCCACTAGCAGCTTTACGG and ATTGTCCAAAGGTAAATAATTGG) targeting mVPS37A gene, the targeting vector and Cas9mRNAwere co-injected into fertilizedmouse eggs to generate targeted knockin offspring.
Article Title: Real-time visualization of reconstituted transcription reveals RNAPII activation mechanisms at single promoters.
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies monoclonal ERCC3 antibody This paper N/A monoclonal TAF4 antibody This paper N/A Chemicals, peptides, and recombinant proteins Alexa Fluor TM 647 C 2 Maleimide Invitrogen Cat#A20347 Biotin-PEG-succinimidyl carbonate Laysan Bio Cat#BIOTIN-PEG-SC-5000-1GR Catalase Sigma-Aldrich Cat#E3289-100MG D-(+)-Glucose Sigma-Aldrich Cat#G8270-100G DTT Sigma-Aldrich Cat#D0632 Glucose oxidase TCI America Cat#G00501G Glutathione Sepharose beads Cytiva Cat#17075601 HBC508 Fluorescence Diagnosis (Shanghai) Biotech Co. Ltd. Cat#H15081 HBC525 Fluorescence Diagnosis (Shanghai) Biotech Co. Ltd. Cat# H15251 L-Glutathione reduced Sigma-Aldrich Cat#G4251 mPEG-succinimidyl valerate Laysan Bio Cat#MPEG-SVA-5000-1G N-(2-Aminoethyl)-3-aminopropyltrimethoxysilane Sigma-Aldrich Cat#8191720100 Phusion High-Fidelity DNA polymerase Thermo Scientific Cat#F530S Pierce TM Dye Removal Columns Thermo Scientific Cat#22858 RNaseOUT TM Invitrogen Cat#10777019 Streptavidin Invitrogen Cat#434301 TBP Active Motif Cat#81114 TetraSpeck Microspheres, 0.1 μm Invitrogen Cat#T7279 TFIIA Protein One Cat#P1032-01 TFIIB Novus Biologicals Cat# NBP1-30313 Trolox Cayman Chemical Cat#NC1980415 T7 RNA Polymerase (20U/uL) Thermo Scientific Cat#EP0112 UltraPure TM BSA Invitrogen Cat#AM2616 SY-5609 Syros Pharmaceuticals N/A Experimental model and study participant details HeLa S3 cells ATCC CCL-2.2 Critical commercial assays Pierce TM RNA 3 ′ End Biotinylation Kit Thermo Scientific Cat#20160 TranscriptAid T7 High Yield Transcription Kit Thermo Scientific Cat#K0441 Oligonucleotides 5 ′ Alexa Fluor 647: /5Alex647N/TTCTCAGGCAG ACTAGGCCATTAGGTG Integrated DNA technologies (IDT) N/A Recombinant DNA pET28a-2Pepper Fluorescence Diagnosis (Shanghai) Biotech Co. Ltd. Cat#PET2802MCS0 FLAG-HSF1 Wang et al. 101 Addgene plasmid #32537 pET-28a-mCherry-MED1-IDR Mensah et al. 102 Addgene plasmid #194545 (Continued on next page) Cell Reports 44, 116251, September 23, 2025 17
Article Title: Individual thalamic inhibitory interneurons are functionally specialized toward distinct visual features.
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Dexamethasone Sigma D2915 Alcaine eye drops Alcon N/A Isoflurane, Attane Piramal Pharma, Provet AG Cat# QN01AB06 Coliquifilm Allergan Cat# S01XA20 Chlorprothixene Sigma Cat# C1671 Experimental models: Organisms/strains Mouse: GAD67-EGFP Tamamaki et al.54 MGI:3590301 Mouse: GAD2-IRES-Cre Taniguchi et al.52; NIH Neuroscience Blueprint Cre Driver Network et al. JAX: 010802; RRID: IMSR_JAX:010802 Mouse: vgat-IRES-Cre Vong et al.99 RRID: IMSR_JAX:028862 Mouse: Ai3 (EYFP reporter) Madisen et al.53 JAX: 007903; RRID: IMSR_JAX:007903 Mouse: Ai94(TITL-GCaMP6s)-D Madisen et al.100 RRID: IMSR_JAX:024104 Mouse: CAG-stop-tTA2 Miyamichi et al.73 RRID: IMSR_JAX:014092 Mouse: Frmd7tm1a(KOMP)Wtsi Knouckout Mouse Project (KOMP) EM: 07372; RRID: IMSR_EM:07372 Mouse: Cart-IRES2-Cre-D Jackson JAX:028533; RRID: IMSR_JAX:028533 Recombinant DNA Plasmid: pAAV-Ef1a-DIO-oG-WPRE Kim et al.101 N/A Plasmid: pAAV-EF1a-CVS11-GWPREhGHpA Wertz et al.102 Addgene plasmid # 67528; RRID: Addgene_67528 Plasmid: pAAV-EF1a-tdTomatoWPRE-hGHpA Wertz et al.102 Addgene plasmid # 67527; RRID: Addgene_67527 Plasmid: pCMMP-TVA800 Wickersham et al.51 Addgene plasmid # 15778; RRID: Addgene_15778 Plasmid: pAAV-EF1a-DIO-TVA-WPREhGHpA Rompani et al. N/A Plasmid: pAAV-CAG-DIOmWGA-mCherry-WPRE Tsai et al.72 N/A Software and algorithms Custom code (Python) for machine-learning assisted ChAT-band detection This manuscript https://github.com/fmi-basel/faim-retina-chatbands; Zenodo: https://doi.org/10.5281/zenodo.11354455 Python 3.6 Python Software Foundation RRID: SCR_008394; https://www.python.org/downloads/ release/python-360/ Keras 2.2.4 François Chollet https://keras.io/ TensorFlow 1.12.0 Google RRID: SCR_016345; https://www.tensorflow.org/ Fiji/ImageJ Fiji/ImageJ RRID: SCR_002285 MATLAB 2019b/2022b Mathworks RRID: SCR_001622; https://www.mathworks.com/products/matlab.html BioFormats MATLAB toolbox 6.10.0 The Open Microscopy Environment; Linkert et al.103 RRID: SCR_000450; https://downloads.openmicroscopy.org/bio-formats/ Probability calculations and Monte-Carlo simulations Rompani et al.22 https://ch.mathworks.com/matlabcentral/ fileexchange/61185-presynaptic-mapping Custom code (MATLAB) to analyze data This manuscript https://github.com/fionamuellner/flex-calc-imag; Zenodo: https://doi.org/10.5281/zenodo.11397956 Other Premium standard wall borosilicate capillary glass pipette Warner Instruments Cat# G100-4 Standard Wall Borosilicate Tubing with Filament Sutter Instruments Cat# BF100-50-10 (Continued on next page) e2 Neuron 112, 2765–2782.e1–e9, August 21, 2024
Sequencing:Article Title: Targeting PGAM5-driven mitochondrial integrated stress response slows ALS progression across subtypes.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Oligonucleotides See Table S3 for the sequence information of qPCR primers, shRNAs, siRNAs and sgRNAs This study N/A Recombinant DNA pMSCV-F-del-Casp9-IRES-GFP Straathof et al. 98 Addgene plasmid# 15567 rtTA-N144 Richner et al. 99 Addgene plasmid# 66810 pXG237 Guo et al. 40 Addgene plasmid# 141281 pRK5-HA-Ubiquitin-WT Lim et al. 100 Addgene plasmid# 17608 pMDLg/pRRE Dull et al. 101 Addgene plasmid# 12251 pRSV-Rev Dull et al. 101 Addgene plasmid# 12253 psPAX2 A gift from Didier Trono Addgene plasmid# 12260 pMD2.G A gift from Didier Trono Addgene plasmid# 12259 pVSV-G Dull et al. 101 Addgene plasmid# 138479 pLKO.1 Moffat et al. 102 Addgene plasmid# 10878 pHAGE-CMV-MCS-PGK-Puro Clontech Laboratories N/A pGEX-6P-1-GST Cytiva Cat# 28954648 pET-28a(+)-HIS MERCK Cat# 69864 pCMV-Myc Takara Bio Cat# 635689 Myc-VCP and mutants This study N/A uORFs-iCasp9-HA This study N/A pHAGE-PGAM5-3xFlag and mutants This study N/A GST-PGAM5 and mutants This study N/A His-OMA1 This study N/A His-PO1 This study N/A HA-OMA1 and mutants This study N/A pHAGE-DELE1-3xFlag This study N/A Software and algorithms Maestro Schrö dinger https://www.schrodinger.com/platform/ products/maestro/ GraphPad Prism GraphPad https://www.graphpad.com/ scientificsoftware/prism/ GSEA Broad Institute http://software.broadinstitute.org/gsea/ login.jsp ImageJ ImageJ https://imagej.nih.gov/ij/ ZEN 2.3 (blue edition) Carl Zeiss https://www.zeiss.com/microscopy/en/ products/software/zeiss-zen.html R version 4.4.0 The R Foundation https://www.r-project.org/ Neuron 114, 1–19.e1–e14, June 17, 2026 e6 ..
Real-time Polymerase Chain Reaction:Article Title: Targeting PGAM5-driven mitochondrial integrated stress response slows ALS progression across subtypes.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Oligonucleotides See Table S3 for the sequence information of qPCR primers, shRNAs, siRNAs and sgRNAs This study N/A Recombinant DNA pMSCV-F-del-Casp9-IRES-GFP Straathof et al. 98 Addgene plasmid# 15567 rtTA-N144 Richner et al. 99 Addgene plasmid# 66810 pXG237 Guo et al. 40 Addgene plasmid# 141281 pRK5-HA-Ubiquitin-WT Lim et al. 100 Addgene plasmid# 17608 pMDLg/pRRE Dull et al. 101 Addgene plasmid# 12251 pRSV-Rev Dull et al. 101 Addgene plasmid# 12253 psPAX2 A gift from Didier Trono Addgene plasmid# 12260 pMD2.G A gift from Didier Trono Addgene plasmid# 12259 pVSV-G Dull et al. 101 Addgene plasmid# 138479 pLKO.1 Moffat et al. 102 Addgene plasmid# 10878 pHAGE-CMV-MCS-PGK-Puro Clontech Laboratories N/A pGEX-6P-1-GST Cytiva Cat# 28954648 pET-28a(+)-HIS MERCK Cat# 69864 pCMV-Myc Takara Bio Cat# 635689 Myc-VCP and mutants This study N/A uORFs-iCasp9-HA This study N/A pHAGE-PGAM5-3xFlag and mutants This study N/A GST-PGAM5 and mutants This study N/A His-OMA1 This study N/A His-PO1 This study N/A HA-OMA1 and mutants This study N/A pHAGE-DELE1-3xFlag This study N/A Software and algorithms Maestro Schrö dinger https://www.schrodinger.com/platform/ products/maestro/ GraphPad Prism GraphPad https://www.graphpad.com/ scientificsoftware/prism/ GSEA Broad Institute http://software.broadinstitute.org/gsea/ login.jsp ImageJ ImageJ https://imagej.nih.gov/ij/ ZEN 2.3 (blue edition) Carl Zeiss https://www.zeiss.com/microscopy/en/ products/software/zeiss-zen.html R version 4.4.0 The R Foundation https://www.r-project.org/ Neuron 114, 1–19.e1–e14, June 17, 2026 e6 ..
Recombinant:Article Title: Targeting PGAM5-driven mitochondrial integrated stress response slows ALS progression across subtypes.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Oligonucleotides See Table S3 for the sequence information of qPCR primers, shRNAs, siRNAs and sgRNAs This study N/A Recombinant DNA pMSCV-F-del-Casp9-IRES-GFP Straathof et al. 98 Addgene plasmid# 15567 rtTA-N144 Richner et al. 99 Addgene plasmid# 66810 pXG237 Guo et al. 40 Addgene plasmid# 141281 pRK5-HA-Ubiquitin-WT Lim et al. 100 Addgene plasmid# 17608 pMDLg/pRRE Dull et al. 101 Addgene plasmid# 12251 pRSV-Rev Dull et al. 101 Addgene plasmid# 12253 psPAX2 A gift from Didier Trono Addgene plasmid# 12260 pMD2.G A gift from Didier Trono Addgene plasmid# 12259 pVSV-G Dull et al. 101 Addgene plasmid# 138479 pLKO.1 Moffat et al. 102 Addgene plasmid# 10878 pHAGE-CMV-MCS-PGK-Puro Clontech Laboratories N/A pGEX-6P-1-GST Cytiva Cat# 28954648 pET-28a(+)-HIS MERCK Cat# 69864 pCMV-Myc Takara Bio Cat# 635689 Myc-VCP and mutants This study N/A uORFs-iCasp9-HA This study N/A pHAGE-PGAM5-3xFlag and mutants This study N/A GST-PGAM5 and mutants This study N/A His-OMA1 This study N/A His-PO1 This study N/A HA-OMA1 and mutants This study N/A pHAGE-DELE1-3xFlag This study N/A Software and algorithms Maestro Schrö dinger https://www.schrodinger.com/platform/ products/maestro/ GraphPad Prism GraphPad https://www.graphpad.com/ scientificsoftware/prism/ GSEA Broad Institute http://software.broadinstitute.org/gsea/ login.jsp ImageJ ImageJ https://imagej.nih.gov/ij/ ZEN 2.3 (blue edition) Carl Zeiss https://www.zeiss.com/microscopy/en/ products/software/zeiss-zen.html R version 4.4.0 The R Foundation https://www.r-project.org/ Neuron 114, 1–19.e1–e14, June 17, 2026 e6 ..
Plasmid Preparation:Article Title: Targeting PGAM5-driven mitochondrial integrated stress response slows ALS progression across subtypes.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Oligonucleotides See Table S3 for the sequence information of qPCR primers, shRNAs, siRNAs and sgRNAs This study N/A Recombinant DNA pMSCV-F-del-Casp9-IRES-GFP Straathof et al. 98 Addgene plasmid# 15567 rtTA-N144 Richner et al. 99 Addgene plasmid# 66810 pXG237 Guo et al. 40 Addgene plasmid# 141281 pRK5-HA-Ubiquitin-WT Lim et al. 100 Addgene plasmid# 17608 pMDLg/pRRE Dull et al. 101 Addgene plasmid# 12251 pRSV-Rev Dull et al. 101 Addgene plasmid# 12253 psPAX2 A gift from Didier Trono Addgene plasmid# 12260 pMD2.G A gift from Didier Trono Addgene plasmid# 12259 pVSV-G Dull et al. 101 Addgene plasmid# 138479 pLKO.1 Moffat et al. 102 Addgene plasmid# 10878 pHAGE-CMV-MCS-PGK-Puro Clontech Laboratories N/A pGEX-6P-1-GST Cytiva Cat# 28954648 pET-28a(+)-HIS MERCK Cat# 69864 pCMV-Myc Takara Bio Cat# 635689 Myc-VCP and mutants This study N/A uORFs-iCasp9-HA This study N/A pHAGE-PGAM5-3xFlag and mutants This study N/A GST-PGAM5 and mutants This study N/A His-OMA1 This study N/A His-PO1 This study N/A HA-OMA1 and mutants This study N/A pHAGE-DELE1-3xFlag This study N/A Software and algorithms Maestro Schrö dinger https://www.schrodinger.com/platform/ products/maestro/ GraphPad Prism GraphPad https://www.graphpad.com/ scientificsoftware/prism/ GSEA Broad Institute http://software.broadinstitute.org/gsea/ login.jsp ImageJ ImageJ https://imagej.nih.gov/ij/ ZEN 2.3 (blue edition) Carl Zeiss https://www.zeiss.com/microscopy/en/ products/software/zeiss-zen.html R version 4.4.0 The R Foundation https://www.r-project.org/ Neuron 114, 1–19.e1–e14, June 17, 2026 e6 ..
Software:Article Title: Targeting PGAM5-driven mitochondrial integrated stress response slows ALS progression across subtypes.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Oligonucleotides See Table S3 for the sequence information of qPCR primers, shRNAs, siRNAs and sgRNAs This study N/A Recombinant DNA pMSCV-F-del-Casp9-IRES-GFP Straathof et al. 98 Addgene plasmid# 15567 rtTA-N144 Richner et al. 99 Addgene plasmid# 66810 pXG237 Guo et al. 40 Addgene plasmid# 141281 pRK5-HA-Ubiquitin-WT Lim et al. 100 Addgene plasmid# 17608 pMDLg/pRRE Dull et al. 101 Addgene plasmid# 12251 pRSV-Rev Dull et al. 101 Addgene plasmid# 12253 psPAX2 A gift from Didier Trono Addgene plasmid# 12260 pMD2.G A gift from Didier Trono Addgene plasmid# 12259 pVSV-G Dull et al. 101 Addgene plasmid# 138479 pLKO.1 Moffat et al. 102 Addgene plasmid# 10878 pHAGE-CMV-MCS-PGK-Puro Clontech Laboratories N/A pGEX-6P-1-GST Cytiva Cat# 28954648 pET-28a(+)-HIS MERCK Cat# 69864 pCMV-Myc Takara Bio Cat# 635689 Myc-VCP and mutants This study N/A uORFs-iCasp9-HA This study N/A pHAGE-PGAM5-3xFlag and mutants This study N/A GST-PGAM5 and mutants This study N/A His-OMA1 This study N/A His-PO1 This study N/A HA-OMA1 and mutants This study N/A pHAGE-DELE1-3xFlag This study N/A Software and algorithms Maestro Schrö dinger https://www.schrodinger.com/platform/ products/maestro/ GraphPad Prism GraphPad https://www.graphpad.com/ scientificsoftware/prism/ GSEA Broad Institute http://software.broadinstitute.org/gsea/ login.jsp ImageJ ImageJ https://imagej.nih.gov/ij/ ZEN 2.3 (blue edition) Carl Zeiss https://www.zeiss.com/microscopy/en/ products/software/zeiss-zen.html R version 4.4.0 The R Foundation https://www.r-project.org/ Neuron 114, 1–19.e1–e14, June 17, 2026 e6 ..
|
Addgene inc is a verified supplier 